Stem-loop sequence dre-mir-24-2

AccessionMI0001919 (change log)
DescriptionDanio rerio miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Literature search

6 open access papers mention dre-mir-24-2
(83 sentences)

Stem-loop
   g   ug u       g       u     uaa     g ac 
5'  ggc  g cuccugu ccugcug gcuga   ucagu g  g
    |||  | ||||||| ||||||| |||||   ||||| |  g
3'  cug  c ggggaca ggacgac ugacu   gguca u  c
   -   gu c       a       u     --c     g gu 
Get sequence
Deep sequencing
21408 reads, 1.12e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 13412979-13413060 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-24-2
dre-mir-23a-2chr3: 13406226-13406323 [+]
dre-mir-27cchr3: 13406451-13406538 [+]
dre-mir-24-2chr3: 13412979-13413060 [+]
Database links

Mature sequence dre-miR-24

Accession MIMAT0001792
Sequence

51 - 

uggcucaguucagcaggaacag

 - 72

Get sequence
Deep sequencing85524 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).