Stem-loop sequence dre-mir-23b

AccessionMI0001917 (change log)
DescriptionDanio rerio miR-23b stem-loop
Gene family MIPF0000027; mir-23
Literature search

12 open access papers mention dre-mir-23b
(58 sentences)

Stem-loop
       cu      --          -  c      ---gug  u 
5' gugg  gugugg  guucuuggca ug ugauuu      ac g
   ||||  ||||||  |||||||||| || ||||||      ||  
3' cacc  cacacc  uagggaccgu ac acuaaa      ug u
       au      au          u  -      aaaaaa  a 
Get sequence
Deep sequencing
31718 reads, 3.74e+03 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 15954579-15954659 [+]
antisense
OTTDART00000043259 ; si:dkey-3h23.2-002; exon 3
OTTDART00000043258 ; si:dkey-3h23.2-001; exon 4
ENSDART00000142357 ; si:dkey-3h23.2-002; exon 3
ENSDART00000144692 ; si:dkey-3h23.2-001; exon 4
Clustered miRNAs
< 10kb from dre-mir-23b
dre-mir-23bchr10: 15954579-15954659 [+]
dre-mir-27dchr10: 15954727-15954815 [+]
dre-mir-24-1chr10: 15960835-15960914 [+]
Database links

Mature sequence dre-miR-23b

Accession MIMAT0001791
Sequence

51 - 

aucacauugccagggauuacca

 - 72

Get sequence
Deep sequencing31707 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).