Stem-loop sequence dre-mir-23a-1

AccessionMI0001913 (change log)
DescriptionDanio rerio miR-23a-1 stem-loop
Gene family MIPF0000027; mir-23
Literature search

11 open access papers mention dre-mir-23a-1
(208 sentences)

Stem-loop
         g    - a  --          cc       gguggauaaa  g 
5' gcugug cggg g gg  guuccuggca  gugauuu          ca a
   |||||| |||| | ||  ||||||||||  |||||||          ||  
3' uggcac gucc c cc  uagggaccgu  cacuaaa          gu a
         -    u a  uu          ua       ---------a  a 
Get sequence
Deep sequencing
33271 reads, 3.85e+03 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr22: 5293213-5293301 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-23a-1
dre-mir-23a-1chr22: 5293213-5293301 [+]
dre-mir-27echr22: 5299951-5300056 [+]
Database links

Mature sequence dre-miR-23a-3p

Accession MIMAT0001790
Previous IDsdre-miR-23a
Sequence

56 - 

aucacauugccagggauuucca

 - 77

Get sequence
Deep sequencing95168 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).