Stem-loop sequence dre-mir-22b

AccessionMI0001912 (change log)
DescriptionDanio rerio miR-22b stem-loop
Gene family MIPF0000053; mir-22
Literature search

5 open access papers mention dre-mir-22b
(7 sentences)

Stem-loop
         u     uc        -     u       -u   g 
5' guuacu cacag  guucuuca cuggc agcuuua  gug c
   |||||| |||||  |||||||| ||||| |||||||  |||  
3' caaugg guguu  cgagaagu gaccg ucgaaau  cac a
         -     gu        u     -       uc   g 
Get sequence
Deep sequencing
180282 reads, 1.52e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 12610802-12610883 [+]
sense
OTTDART00000030000 ; si:dkey-98f17.5-001; intron 4
ENSDART00000133167 ; si:dkey-98f17.5-001; intron 4
KZ115105.1: 46708-46789 [+]
sense
OTTDART00000030000 ; si:dkey-98f17.5-001; intron 4
ENSDART00000133167 ; si:dkey-98f17.5-001; intron 4
Database links

Mature sequence dre-miR-22b-5p

Accession MIMAT0031943
Sequence

14 - 

cguucuucacuggcuagcuuua

 - 35

Get sequence
Deep sequencing158 reads, 11 experiments
Evidence not experimental
Database links

Mature sequence dre-miR-22b-3p

Accession MIMAT0001789
Previous IDsdre-miR-22b
Sequence

51 - 

aagcugccaguugaagagcugu

 - 72

Get sequence
Deep sequencing180124 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).