Stem-loop sequence dre-mir-21-2

AccessionMI0001909 (change log)
DescriptionDanio rerio miR-21-2 stem-loop
Gene family MIPF0000060; mir-21
Literature search

21 open access papers mention dre-mir-21-2
(174 sentences)

Stem-loop
           a   ---aa    -u   uuuc     ug        c      g     g uuug 
5' agacagac gua     agug  ccc    uguca  uagcuuau agacug uguug c    a
   |||||||| |||     ||||  |||    |||||  |||||||| |||||| ||||| |    g
3' uuuguuug cau     uuau  ggg    acagu  gucggaua ucugac acaac g    u
           g   gcagc    uc   uuuu     cu        a      g     g uuuu 
Get sequence
Deep sequencing
2639159 reads, 1.85e+05 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr15: 17373789-17373915 [+]
intergenic
Database links

Mature sequence dre-miR-21

Accession MIMAT0001787
Sequence

34 - 

uagcuuaucagacugguguuggc

 - 56

Get sequence
Deep sequencing5286827 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).