Stem-loop sequence dre-mir-21-1

AccessionMI0001908 (change log)
DescriptionDanio rerio miR-21-1 stem-loop
Gene family MIPF0000060; mir-21
Literature search

21 open access papers mention dre-mir-21-1
(174 sentences)

Stem-loop
         gucuuu     c u   uau    cuuu     u               u       g     g   uuac 
5' uuaugu      auugg g gga   aagu    cccag gugucagauagcuua cagacug uguug cug    a
   ||||||      ||||| | |||   ||||    ||||| ||||||||||||||| ||||||| ||||| |||    u
3' aguaua      uagcc c ucu   uuua    ggguu uacagucugucggau gucugac acagc ggc    u
         -aaaau     u u   ---    ---c     u               -       a     -   ccgc 
Get sequence
Deep sequencing
2650077 reads, 1.85e+05 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 28198894-28199041 [-]
intergenic
KZ115325.1: 323135-323282 [-]
intergenic
Database links

Mature sequence dre-miR-21

Accession MIMAT0001787
Sequence

49 - 

uagcuuaucagacugguguuggc

 - 71

Get sequence
Deep sequencing5286827 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).