Stem-loop sequence dre-mir-20a

AccessionMI0001907 (change log)
DescriptionDanio rerio miR-20a stem-loop
Gene family MIPF0000001; mir-17
Literature search

9 open access papers mention dre-mir-20a
(13 sentences)

Stem-loop
      uaaau      c uaau   g   u      a     uc  c      -a           g     g   uauuu 
5' ucu     aaaucu c    guu cag uguguu gaguu  ag agugcu  aagugcuuaua ugcag uag     c
   |||     |||||| |    ||| ||| |||||| |||||  || ||||||  ||||||||||| ||||| |||      
3' aga     uuuaga g    uag guc gcguaa uucga  uc ucauga  uucacgagugu acguc auc     u
      ucguc      a --cc   g   u      -     --  u      ag           g     -   uacug 
Get sequence
Deep sequencing
86396 reads, 2.76e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 3297603-3297755 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-20a
dre-mir-17a-1chr1: 3298112-3298249 [-]
dre-mir-18achr1: 3298006-3298088 [-]
dre-mir-19achr1: 3297848-3297936 [-]
dre-mir-20achr1: 3297603-3297755 [-]
dre-mir-19bchr1: 3297484-3297570 [-]
dre-mir-92a-1chr1: 3297367-3297451 [-]
Database links

Mature sequence dre-miR-20a-5p

Accession MIMAT0001786
Previous IDsdre-miR-20a
Sequence

51 - 

uaaagugcuuauagugcagguag

 - 73

Get sequence
Deep sequencing81124 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-20a-3p

Accession MIMAT0003400
Previous IDsdre-miR-20a*
Sequence

88 - 

acugcagugugagcacuugaag

 - 109

Get sequence
Deep sequencing5262 reads, 11 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).