Stem-loop sequence dre-mir-19a

AccessionMI0001903 (change log)
DescriptionDanio rerio miR-19a stem-loop
Gene family MIPF0000011; mir-19
Literature search

8 open access papers mention dre-mir-19a
(142 sentences)

Stem-loop
   uggu    uu u  gc             --      uacaagaa   g 
5'     gcag  c cu  uaguuuugcauag  uugcac        aac g
       ||||  | ||  |||||||||||||  ||||||        |||  
3'     cguc  g gg  gucaaaacguauc  aacgug        uug g
   -cgu    cg u  ua             ua      --------   a 
Get sequence
Deep sequencing
28508 reads, 1.8e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 3297848-3297936 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-19a
dre-mir-17a-1chr1: 3298112-3298249 [-]
dre-mir-18achr1: 3298006-3298088 [-]
dre-mir-19achr1: 3297848-3297936 [-]
dre-mir-20achr1: 3297603-3297755 [-]
dre-mir-19bchr1: 3297484-3297570 [-]
dre-mir-92a-1chr1: 3297367-3297451 [-]
Database links

Mature sequence dre-miR-19a-5p

Accession MIMAT0003398
Previous IDsdre-miR-19a*
Sequence

16 - 

cuaguuuugcauaguugcacua

 - 37

Get sequence
Deep sequencing183 reads, 9 experiments
Evidence experimental; cloned [1]
Database links

Mature sequence dre-miR-19a-3p

Accession MIMAT0001782
Previous IDsdre-miR-19a
Sequence

53 - 

ugugcaaaucuaugcaaaacuga

 - 75

Get sequence
Deep sequencing28325 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).