Stem-loop sequence dre-mir-18c

AccessionMI0001902 (change log)
DescriptionDanio rerio miR-18c stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention dre-mir-18c
(2 sentences)

Stem-loop
   -  -c         --   u      u       ua   -a  u 
5'  gc  uuccugcua  agg gcaucu guguagu  gug  ag a
    ||  |||||||||  ||| |||||| |||||||  |||  ||  
3'  cg  gaggacggu  ucc uguaga cgcguca  uau  uc g
   u  au         uu   u      u       uc   ga  u 
Get sequence
Deep sequencing
44643 reads, 1.23e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 31467376-31467460 [-]
intergenic
KZ115452.1: 23480-23564 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-18c
dre-mir-18cchr14: 31467376-31467460 [-]
dre-mir-20bchr14: 31467167-31467260 [-]
dre-mir-19cchr14: 31467026-31467130 [-]
dre-mir-363chr14: 31466671-31466797 [-]
Database links

Mature sequence dre-miR-18c

Accession MIMAT0001781
Sequence

11 - 

uaaggugcaucuuguguaguua

 - 32

Get sequence
Deep sequencing44230 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).