Stem-loop sequence dre-mir-18b

AccessionMI0001901 (change log)
DescriptionDanio rerio miR-18b stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention dre-mir-18b
(2 sentences)

Stem-loop
   ua  g         --   u        u    a   -  aaau 
5'   cu cuuaugcua  agg gcauuuag gcag uag ug    a
     || |||||||||  ||| |||||||| |||| ||| ||    g
3'   gg gaauacggu  ucc cgugaauc cguc auc ac    a
   uc  g         cu   c        c    -   c  gauc 
Get sequence
Deep sequencing
4823 reads, 209 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 53436831-53436917 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-18b
dre-mir-17a-2chr9: 53436944-53437026 [-]
dre-mir-18bchr9: 53436831-53436917 [-]
dre-mir-92a-2chr9: 53436280-53436374 [-]
Database links

Mature sequence dre-miR-18b-5p

Accession MIMAT0001780
Previous IDsdre-miR-18b
Sequence

13 - 

uaaggugcauuuagugcagaua

 - 34

Get sequence
Deep sequencing4627 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-18b-3p

Accession MIMAT0003397
Previous IDsdre-miR-18b*
Sequence

55 - 

cugcccuaagugccccuucugg

 - 76

Get sequence
Deep sequencing66 reads, 9 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).