Stem-loop sequence dre-mir-18a

AccessionMI0001900 (change log)
DescriptionDanio rerio miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

5 open access papers mention dre-mir-18a
(6 sentences)

Stem-loop
   gg          --   u   uc   u    a   -  -a  u 
5'   cuuugugcua  agg gca  uag gcag uag ug  ag a
     ||||||||||  ||| |||  ||| |||| ||| ||  ||  
3'   ggagcacggu  ucc cgu  auc cguc auc ac  uc g
   ug          cu   u   ga   c    -   c  ga  a 
Get sequence
Deep sequencing
5123 reads, 209 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 3298006-3298088 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-18a
dre-mir-17a-1chr1: 3298112-3298249 [-]
dre-mir-18achr1: 3298006-3298088 [-]
dre-mir-19achr1: 3297848-3297936 [-]
dre-mir-20achr1: 3297603-3297755 [-]
dre-mir-19bchr1: 3297484-3297570 [-]
dre-mir-92a-1chr1: 3297367-3297451 [-]
Database links

Mature sequence dre-miR-18a

Accession MIMAT0001779
Sequence

11 - 

uaaggugcaucuagugcagaua

 - 32

Get sequence
Deep sequencing4917 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).