Stem-loop sequence dre-mir-17a-2

AccessionMI0001898 (change log)
DescriptionDanio rerio miR-17a-2 stem-loop
Gene family MIPF0000001; mir-17
Literature search

20 open access papers mention dre-mir-17a-2
(169 sentences)

Stem-loop
        u    u  -ca        a  g     g   uuca 
5' gucac guag gu   aagugcuu ca ugcag uag    a
   ||||| |||| ||   |||||||| || ||||| |||    u
3' cagug cauu cg   uucacgga gu acguc auc    a
        c    u  aac        g  g     -   uaau 
Get sequence
Deep sequencing
33395 reads, 1.2e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 53436944-53437026 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-17a-2
dre-mir-17a-2chr9: 53436944-53437026 [-]
dre-mir-18bchr9: 53436831-53436917 [-]
dre-mir-92a-2chr9: 53436280-53436374 [-]
Database links

Mature sequence dre-miR-17a-5p

Accession MIMAT0001777
Previous IDsdre-miR-17a
Sequence

14 - 

caaagugcuuacagugcaggua

 - 35

Get sequence
Deep sequencing64667 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-17a-2-3p

Accession MIMAT0031938
Sequence

50 - 

acugcaguggaggcacuucaagc

 - 72

Get sequence
Deep sequencing1073 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).