Stem-loop sequence dre-mir-17a-1

AccessionMI0001897 (change log)
DescriptionDanio rerio miR-17a-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

20 open access papers mention dre-mir-17a-1
(169 sentences)

Stem-loop
      cuuu    a u   cuu      ---u     -        -ca        a  g     g   -    a 
5' gga    cuug g gga   gguugg    gucaa uguauugu   aagugcuu ca ugcag uag uauu u
   |||    |||| | |||   ||||||    ||||| ||||||||   |||||||| || ||||| ||| ||||  
3' ccu    ggac c ccu   ccaauu    caguu acauaacg   uucacgga gu acguc auc auaa g
      --ac    - u   --u      uuac     c        auc        g  g     -   u    g 
Get sequence
Deep sequencing
33446 reads, 1.2e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 3298112-3298249 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-17a-1
dre-mir-17a-1chr1: 3298112-3298249 [-]
dre-mir-18achr1: 3298006-3298088 [-]
dre-mir-19achr1: 3297848-3297936 [-]
dre-mir-20achr1: 3297603-3297755 [-]
dre-mir-19bchr1: 3297484-3297570 [-]
dre-mir-92a-1chr1: 3297367-3297451 [-]
Database links

Mature sequence dre-miR-17a-5p

Accession MIMAT0001777
Previous IDsdre-miR-17a
Sequence

41 - 

caaagugcuuacagugcaggua

 - 62

Get sequence
Deep sequencing64667 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-17a-3p

Accession MIMAT0003396
Previous IDsdre-miR-17a*
Sequence

79 - 

acugcaguggaggcacuucuag

 - 100

Get sequence
Deep sequencing1079 reads, 11 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).