Stem-loop sequence dre-mir-16c

AccessionMI0001896 (change log)
DescriptionDanio rerio miR-16c stem-loop
Gene family MIPF0000006; mir-15
Literature search

10 open access papers mention dre-mir-16c
(16 sentences)

Stem-loop
       u  -           -  ---   uug                  -ua         guuacuccuu   c 
5' gagg ug ugugugugugc gu   gug   ucuugcuuuagcagcaug   aauauugga          ggc a
   |||| || ||||||||||| ||   |||   ||||||||||||||||||   |||||||||          |||  
3' uucc ac gcacguacacg cg   cac   agaacgaagucgucgugc   uuauaaccu          ccg a
       u  u           a  aac   uga                  ucg         ----------   u 
Get sequence
Deep sequencing
31263 reads, 5.92e+04 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 29652352-29652487 [-]
sense
OTTDART00000059692 ; si:ch211-261i19.3-002; exon 2
OTTDART00000059691 ; si:ch211-261i19.3-001; exon 3
ENSDART00000156609 ; si:ch211-261i19.3-002; exon 2
ENSDART00000154709 ; si:ch211-261i19.3-001; exon 3
antisense
OTTDART00000059690 ; trim13-002; intron 2
ENSDART00000157265 ; trim13-002; intron 2
KZ114910.1: 16404-16539 [-]
sense
OTTDART00000059692 ; si:ch211-261i19.3-002; exon 2
OTTDART00000059691 ; si:ch211-261i19.3-001; exon 3
ENSDART00000156609 ; si:ch211-261i19.3-002; exon 2
ENSDART00000154709 ; si:ch211-261i19.3-001; exon 3
antisense
OTTDART00000059690 ; trim13-002; intron 2
ENSDART00000157265 ; trim13-002; intron 2
Clustered miRNAs
< 10kb from dre-mir-16c
dre-mir-15a-2chr9: 29652511-29652612 [-]
dre-mir-16cchr9: 29652352-29652487 [-]
Database links

Mature sequence dre-miR-16c-5p

Accession MIMAT0001776
Previous IDsdre-miR-16c
Sequence

35 - 

uagcagcauguaaauauuggag

 - 56

Get sequence
Deep sequencing23878 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-16c-3p

Accession MIMAT0031937
Sequence

76 - 

uccaauauugcucgugcugcuga

 - 98

Get sequence
Deep sequencing7161 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).