Stem-loop sequence dre-mir-16a

AccessionMI0001894 (change log)
DescriptionDanio rerio miR-16a stem-loop
Gene family MIPF0000006; mir-15
Literature search

9 open access papers mention dre-mir-16a
(15 sentences)

Stem-loop
      u   cg  uu           -        u u   aua  c 
5' ccu ccu  cu  agcagcacgua aauauugg g guu   gu a
   ||| |||  ||  ||||||||||| |||||||| | |||   ||  
3' gga gga  ga  ucgucgugugu uuauaacc c caa   cg a
      c   au  cu           a        - -   --c  g 
Get sequence
Deep sequencing
23403 reads, 1.49e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr15: 1543857-1543943 [+]
sense
OTTDART00000025942 ; smc4-001; intron 5
ENSDART00000130413 ; smc4-001; intron 5
ENSDART00000056765 ; smc4-201; intron 5
Clustered miRNAs
< 10kb from dre-mir-16a
dre-mir-15cchr15: 1543686-1543768 [+]
dre-mir-16achr15: 1543857-1543943 [+]
Database links

Mature sequence dre-miR-16a

Accession MIMAT0001774
Sequence

13 - 

uagcagcacguaaauauuggug

 - 34

Get sequence
Deep sequencing23349 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).