Stem-loop sequence dre-mir-15b

AccessionMI0001893 (change log)
DescriptionDanio rerio miR-15b stem-loop
Gene family MIPF0000006; mir-15
Literature search

6 open access papers mention dre-mir-15b
(16 sentences)

Stem-loop
   gu       caucuuuuuauuu   -   ga  g   u  ag                 u  ---   a 
5'   cugucgu             agc ccu  gu ccc gu  cagcacaucaugguuug aa   guu u
     |||||||             ||| |||  || ||| ||  ||||||||||||||||| ||   ||| a
3'   gacagua             uug ggg  cg ggg ca  gucguguaguacuaagc uu   cgg a
   -c       --caauuaccucu   a   uc  a   u  cu                 c  aaa   g 
Get sequence
Deep sequencing
10658 reads, 709 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 26070874-26071007 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-15b
dre-mir-15bchr7: 26070874-26071007 [+]
dre-mir-457achr7: 26071426-26071508 [+]
Database links

Mature sequence dre-miR-15b-5p

Accession MIMAT0001773
Previous IDsdre-miR-15b
Sequence

39 - 

uagcagcacaucaugguuugua

 - 60

Get sequence
Deep sequencing9634 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-15b-3p

Accession MIMAT0031936
Sequence

79 - 

cgaaucaugaugugcugucacu

 - 100

Get sequence
Deep sequencing957 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).