Stem-loop sequence dre-mir-15a-2

AccessionMI0001892 (change log)
DescriptionDanio rerio miR-15a-2 stem-loop
Gene family MIPF0000006; mir-15
Literature search

11 open access papers mention dre-mir-15a-2
(25 sentences)

Stem-loop
   gc  -   c  u     uga      a        ga          gugau 
5'   cg agg uc cuagg   uggugu gcagcaca  augguuugug     a
     || ||| || |||||   |||||| ||||||||  ||||||||||      
3'   gc ucc ag ggucc   acuacg cgucgugu  uaccggacgu     c
   -c  a   -  -     uua      a        ag          agaga 
Get sequence
Deep sequencing
1916 reads, 164 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr9: 29652511-29652612 [-]
sense
OTTDART00000059692 ; si:ch211-261i19.3-002; exon 2
OTTDART00000059691 ; si:ch211-261i19.3-001; exon 3
ENSDART00000156609 ; si:ch211-261i19.3-002; exon 2
ENSDART00000154709 ; si:ch211-261i19.3-001; exon 3
antisense
OTTDART00000059690 ; trim13-002; exon 3
ENSDART00000157265 ; trim13-002; exon 3
KZ114910.1: 16563-16664 [-]
sense
OTTDART00000059692 ; si:ch211-261i19.3-002; exon 2
OTTDART00000059691 ; si:ch211-261i19.3-001; exon 3
ENSDART00000156609 ; si:ch211-261i19.3-002; exon 2
ENSDART00000154709 ; si:ch211-261i19.3-001; exon 3
antisense
OTTDART00000059690 ; trim13-002; exon 3
ENSDART00000157265 ; trim13-002; exon 3
Clustered miRNAs
< 10kb from dre-mir-15a-2
dre-mir-15a-2chr9: 29652511-29652612 [-]
dre-mir-16cchr9: 29652352-29652487 [-]
Database links

Mature sequence dre-miR-15a-5p

Accession MIMAT0001772
Previous IDsdre-miR-15a
Sequence

25 - 

uagcagcacagaaugguuugug

 - 46

Get sequence
Deep sequencing3823 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).