Stem-loop sequence dre-mir-15a-1

AccessionMI0001891 (change log)
DescriptionDanio rerio miR-15a-1 stem-loop
Gene family MIPF0000006; mir-15
Literature search

12 open access papers mention dre-mir-15a-1
(27 sentences)

Stem-loop
          guac   a         a          ag  au 
5' ccugucg    ugu gcagcacag augguuugug  uu  a
   |||||||    ||| ||||||||| ||||||||||  ||   
3' ggacagc    acg cgucguguc ugccggacgu  gg  a
          aaca   g         a          gg  gc 
Get sequence
Deep sequencing
1943 reads, 164 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr1: 46722622-46722705 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-15a-1
dre-mir-15a-1chr1: 46722622-46722705 [-]
dre-mir-16bchr1: 46722379-46722518 [-]
Database links

Mature sequence dre-miR-15a-5p

Accession MIMAT0001772
Previous IDsdre-miR-15a
Sequence

14 - 

uagcagcacagaaugguuugug

 - 35

Get sequence
Deep sequencing3823 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-15a-3p

Accession MIMAT0003395
Previous IDsdre-miR-15a*
Sequence

52 - 

caggccguacugugcugcggca

 - 73

Get sequence
Deep sequencing33 reads, 5 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).