Stem-loop sequence dre-mir-10c

AccessionMI0001888 (change log)
DescriptionDanio rerio miR-10c stem-loop
Gene family MIPF0000033; mir-10
Literature search

10 open access papers mention dre-mir-10c
(192 sentences)

Stem-loop
        -    -ua       -   g     c          uaaacag 
5' ccugu cauc   uauauac ccu uagau cggauuugug       a
   ||||| ||||   ||||||| ||| ||||| ||||||||||        
3' ggaua guag   auguaug ggg aucua gcuuaaacac       c
        u    uug       a   g     u          ugacacg 
Get sequence
Deep sequencing
61321 reads, 2.47e+03 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 23720651-23720745 [+]
sense
OTTDART00000024410 ; hoxb3a-001; intron 1
OTTDART00000052973 ; hoxb4a-002; intron 1
ENSDART00000078466 ; hoxb3a-001; intron 1
ENSDART00000151584 ; hoxb4a-002; intron 1
antisense
OTTDART00000052970 ; si:ch73-4e5.1-004; intron 2
OTTDART00000052969 ; si:ch73-4e5.1-002; intron 4
ENSDART00000154772 ; si:ch73-4e5.1-004; intron 2
ENSDART00000157300 ; si:ch73-4e5.1-002; intron 4
Database links

Mature sequence dre-miR-10c-5p

Accession MIMAT0001770
Previous IDsdre-miR-10c
Sequence

16 - 

uacccuguagauccggauuugu

 - 37

Get sequence
Deep sequencing60699 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-10c-3p

Accession MIMAT0031935
Sequence

58 - 

aaauucguaucuaggggagua

 - 78

Get sequence
Deep sequencing590 reads, 8 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).