Stem-loop sequence dre-mir-10b-2

AccessionMI0001887 (change log)
DescriptionDanio rerio miR-10b-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

16 open access papers mention dre-mir-10b-2
(189 sentences)

Stem-loop
   -gua         a   ac        ac  a       uccaaaa 
5'     gucgucuau ugu  ccuguaga  cg auuugug       c
       ||||||||| |||  ||||||||  || |||||||        
3'     cagcgggua aua  ggacaucu  gc uaaacgc       a
   aaug         c   -a        cu  a       uaaaacu 
Get sequence
Deep sequencing
509174 reads, 2.97e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 36130001-36130092 [+]
sense
OTTDART00000059220 ; hoxc3a-004; intron 2
OTTDART00000019709 ; hoxc3a-003; intron 2
OTTDART00000019708 ; hoxc3a-002; intron 2
ENSDART00000154825 ; hoxc3a-004; intron 2
ENSDART00000128533 ; hoxc3a-003; intron 2
ENSDART00000137507 ; hoxc3a-002; intron 2
ENSDART00000082472 ; hoxc3a-201; intron 2
antisense
OTTDART00000058629 ; si:dkey-81p22.11-002; intron 3
OTTDART00000059834 ; si:dkey-81p22.11-004; intron 3
OTTDART00000059835 ; si:dkey-81p22.11-003; intron 4
OTTDART00000059838 ; si:dkey-81p22.11-007; intron 4
OTTDART00000019699 ; si:dkey-81p22.11-001; intron 5
OTTDART00000059833 ; si:dkey-81p22.11-008; intron 5
OTTDART00000059837 ; si:dkey-81p22.11-006; intron 5
OTTDART00000059836 ; si:dkey-81p22.11-005; intron 6
ENSDART00000153206 ; si:dkey-81p22.11-002; intron 3
ENSDART00000155040 ; si:dkey-81p22.11-004; intron 3
ENSDART00000156899 ; si:dkey-81p22.11-003; intron 4
ENSDART00000155063 ; si:dkey-81p22.11-007; intron 4
ENSDART00000143609 ; si:dkey-81p22.11-001; intron 5
ENSDART00000155822 ; si:dkey-81p22.11-008; intron 5
ENSDART00000153852 ; si:dkey-81p22.11-006; intron 5
ENSDART00000157077 ; si:dkey-81p22.11-005; intron 6
Database links

Mature sequence dre-miR-10b-5p

Accession MIMAT0001268
Previous IDsdre-miR-10b
Sequence

16 - 

uacccuguagaaccgaauuugug

 - 38

Get sequence
Deep sequencing1017976 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-10b-2-3p

Accession MIMAT0031934
Sequence

57 - 

caaauacgucucuacaggaau

 - 77

Get sequence
Deep sequencing339 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).