Stem-loop sequence dre-mir-9-6

AccessionMI0001885 (change log)
DescriptionDanio rerio miR-9-6 stem-loop
Gene family MIPF0000014; mir-9
Literature search

22 open access papers mention dre-mir-9-6
(212 sentences)

Stem-loop
        ua   g   uc               g      u  uu 
5' ggagg  guu cua  uuugguuaucuagcu uaugag gu  a
   |||||  ||| |||  ||||||||||||||| |||||| ||   
3' ccucc  uaa gau  aagccaauagaucga auacuu cg  u
        ug   a   ga               a      c  uc 
Get sequence
Deep sequencing
50174 reads, 1.6e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 14379544-14379631 [-]
intergenic
Database links

Mature sequence dre-miR-9-5p

Accession MIMAT0001769
Previous IDsdre-miR-9
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Deep sequencing220384 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-9-3p

Accession MIMAT0003156
Previous IDsdre-miR-9*
Sequence

55 - 

uaaagcuagauaaccgaaagu

 - 75

Get sequence
Deep sequencing93449 reads, 11 experiments
Evidence experimental; array [2], in-situ [2]
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).