Stem-loop sequence dre-mir-9-5

AccessionMI0001884 (change log)
DescriptionDanio rerio miR-9-5 stem-loop
Gene family MIPF0000014; mir-9
Literature search

22 open access papers mention dre-mir-9-5
(215 sentences)

Stem-loop
      a  g    g   uc               g     -  au 
5' gga gc aguu uua  uuugguuaucuagcu uauga gu  u
   ||| || |||| |||  ||||||||||||||| ||||| ||  u
3' ccu cg ucaa aau  aagccaauagaucga auacu ca  u
      c  -    a   ga               a     u  cg 
Get sequence
Deep sequencing
50202 reads, 1.6e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 48170098-48170184 [-]
sense
OTTDART00000022813 ; si:ch211-202e12.3-002; intron 1
OTTDART00000058609 ; si:ch211-202e12.3-004; intron 1
OTTDART00000022812 ; si:ch211-202e12.3-001; intron 1
OTTDART00000023154 ; si:ch211-202e12.3-003; intron 1
ENSDART00000144252 ; si:ch211-202e12.3-002; intron 1
ENSDART00000153239 ; si:ch211-202e12.3-004; intron 1
ENSDART00000140395 ; si:ch211-202e12.3-001; intron 1
ENSDART00000141802 ; si:ch211-202e12.3-003; intron 1
Database links

Mature sequence dre-miR-9-5p

Accession MIMAT0001769
Previous IDsdre-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing220384 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-9-3p

Accession MIMAT0003156
Previous IDsdre-miR-9*
Sequence

54 - 

uaaagcuagauaaccgaaagu

 - 74

Get sequence
Deep sequencing93449 reads, 11 experiments
Evidence experimental; array [2], in-situ [2]
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).