Stem-loop sequence dre-mir-9-4

AccessionMI0001882 (change log)
DescriptionDanio rerio miR-9-4 stem-loop
Gene family MIPF0000014; mir-9
Literature search

22 open access papers mention dre-mir-9-4
(213 sentences)

Stem-loop
   -u          uucuc       a       g     -   u 
5'   ggguuaguuu     uuugguu ucuagcu uauga guu a
     ||||||||||     ||||||| ||||||| ||||| ||| u
3'   cuuaaucaaa     aagccaa agaucga auacu uag g
   ac          uaugu       g       a     a   u 
Get sequence
Deep sequencing
49180 reads, 1.58e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr22: 18254769-18254855 [+]
sense
OTTDART00000012224 ; si:dkey-11n6.3-001; intron 1
OTTDART00000012225 ; si:dkey-11n6.3-002; intron 2
ENSDART00000141535 ; si:dkey-11n6.3-001; intron 1
ENSDART00000148357 ; si:dkey-11n6.3-002; intron 2
Database links

Mature sequence dre-miR-9-5p

Accession MIMAT0001769
Previous IDsdre-miR-9
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Deep sequencing220384 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-9-4-3p

Accession MIMAT0031932
Sequence

53 - 

uaaagcuagagaaccgaaugua

 - 74

Get sequence
Deep sequencing17716 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).