Stem-loop sequence dre-mir-9-1

AccessionMI0001880 (change log)
DescriptionDanio rerio miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

22 open access papers mention dre-mir-9-1
(217 sentences)

Stem-loop
         ggc     uc               g     ---   u 
5' gggguu   uguua  uuugguuaucuagcu uauga   gug u
   ||||||   |||||  ||||||||||||||| |||||   ||| a
3' cccuaa   acaau  aagccaauagaucga auacu   uac u
         -ga     ga               a     ucu   u 
Get sequence
Deep sequencing
50202 reads, 1.6e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 29216274-29216360 [+]
sense
OTTDART00000023174 ; si:dkey-235h8.1-001; exon 2
ENSDART00000149569 ; si:dkey-235h8.1-001; exon 2
Database links

Mature sequence dre-miR-9-5p

Accession MIMAT0001769
Previous IDsdre-miR-9
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Deep sequencing220384 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-9-3p

Accession MIMAT0003156
Previous IDsdre-miR-9*
Sequence

55 - 

uaaagcuagauaaccgaaagu

 - 75

Get sequence
Deep sequencing93449 reads, 11 experiments
Evidence experimental; array [2], in-situ [2]
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
2
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).