Stem-loop sequence dre-mir-7a-3

AccessionMI0001879 (change log)
DescriptionDanio rerio miR-7a-3 stem-loop
Gene family MIPF0000022; mir-7
Literature search

13 open access papers mention dre-mir-7a-3
(102 sentences)

Stem-loop
   ugugug          ---------    -   g   u   a    a   au        gaaaauga 
5'       uguguucugc         ccuc ugc gag gga gacu gug  uuuguugu        a
         ||||||||||         |||| ||| ||| ||| |||| |||  ||||||||         
3'       acacgagacg         gggg acg cuc ccu cuga cgc  aaacaaca        c
   ------          uccacaccc    c   a   u   g    -   -c        accaaaaa 
Get sequence
Deep sequencing
3550 reads, 118 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 10205-10324 [+]
sense
ENSDART00000017718 ; fem1c-201; intron 3
Database links

Mature sequence dre-miR-7a

Accession MIMAT0001266
Previous IDsdre-miR-7
Sequence

28 - 

uggaagacuagugauuuuguugu

 - 50

Get sequence
Deep sequencing10824 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).