Stem-loop sequence dre-mir-1-1

AccessionMI0001878 (change log)
DescriptionDanio rerio miR-1-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

36 open access papers mention dre-mir-1-1
(187 sentences)

Stem-loop
       ---auaua  c       uag                gc     --  aac 
5' gccc        uc cgcuugg   acauacuucuuuauau  ccaua  ug   a
   ||||        || |||||||   ||||||||||||||||  |||||  ||    
3' cggg        ag guggacc   uguaugaagaaaugua  gguau  ac   a
       gcaaaaag  a       cua                -a     cg  gag 
Get sequence
Deep sequencing
97780 reads, 3.1e+03 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 7210157-7210262 [-]
sense
OTTDART00000059680 ; si:dkey-53i3.1-001; intron 2
ENSDART00000156369 ; si:dkey-53i3.1-001; intron 2
Database links

Mature sequence dre-miR-1

Accession MIMAT0001768
Sequence

62 - 

uggaauguaaagaaguauguau

 - 83

Get sequence
Deep sequencing195388 reads, 9 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).