Stem-loop sequence dre-mir-1-1

AccessionMI0001878
DescriptionDanio rerio miR-1-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    ---auaua  c       uag                gc     --  aac 
gccc        uc cgcuugg   acauacuucuuuauau  ccaua  ug   a
||||        || |||||||   ||||||||||||||||  |||||  ||    
cggg        ag guggacc   uguaugaagaaaugua  gguau  ac   a
    gcaaaaag  a       cua                -a     cg  gag 
Get sequence
Deep sequencing
89974 reads, 8.09e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
23: 7137155-7137260 [+]
sense
OTTDART00000059680 ; si:dkey-53i3.1-001; intron 2
ENSDART00000156369 ; si:dkey-53i3.1-001; intron 2
Database links

Mature sequence dre-miR-1

Accession MIMAT0001768
Sequence

62 - 

uggaauguaaagaaguauguau

 - 83

Get sequence
Deep sequencing87698 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).