Stem-loop sequence dre-mir-1-2

AccessionMI0001877 (change log)
DescriptionDanio rerio miR-1-2 stem-loop
Gene family MIPF0000038; mir-1
Literature search

37 open access papers mention dre-mir-1-2
(190 sentences)

Stem-loop
       -   u  u                  gc     ugaaca 
5' gccu acu gg guacauacuucuuuaugu  ccaua      u
   |||| ||| || ||||||||||||||||||  |||||      a
3' ugga ugg uc uauguaugaagaaaugua  gguau      u
       c   u  u                  -a     cgaaaa 
Get sequence
Deep sequencing
97723 reads, 3.44e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr2: 4116314-4116400 [-]
antisense
ENSDART00000077966 ; MIB1 (1 of 2)-201; intron 1
Clustered miRNAs
< 10kb from dre-mir-1-2
dre-mir-1-2chr2: 4116314-4116400 [-]
dre-mir-133a-1chr2: 4114118-4114216 [-]
Database links

Mature sequence dre-miR-1

Accession MIMAT0001768
Sequence

54 - 

uggaauguaaagaaguauguau

 - 75

Get sequence
Deep sequencing195388 reads, 9 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).