Stem-loop sequence dre-let-7i

AccessionMI0001876 (change log)
DescriptionDanio rerio let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

39 open access papers mention dre-let-7i
(203 sentences)

Stem-loop
   gu        u    u            u    g  ggga      au 
5'   guacuggc gagg aguaguuugugc guug uu    ugugac  u
     |||||||| |||| |||||||||||| |||| ||    ||||||  g
3'   cgugaccg uucc ucaucgaacgcg cagu ag    guauug  c
   gu        -    c            u    -  --ag      cc 
Get sequence
Deep sequencing
4402 reads, 227 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr25: 1629655-1629749 [-]
intergenic
Database links

Mature sequence dre-let-7i

Accession MIMAT0001767
Sequence

11 - 

ugagguaguaguuugugcuguu

 - 32

Get sequence
Deep sequencing4398 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).