Stem-loop sequence dre-let-7g-1

AccessionMI0001873 (change log)
DescriptionDanio rerio let-7g-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

39 open access papers mention dre-let-7g-1
(206 sentences)

Stem-loop
   --  g        aau   gu     u          ----- g     ac 
5'   gg ggcugugg   gag  aguag uuguauaguu     u ggauc  a
     || ||||||||   |||  ||||| ||||||||||     | |||||   
3'   uc ucgacacu   uuc  ucauc gacauaucaa     g ucuag  c
   cc  g        -cu   ug     c          uagag g     ac 
Get sequence
Deep sequencing
253533 reads, 1.74e+04 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 18382456-18382551 [-]
sense
ENSDART00000065881 ; fam120c-201; 3'UTR (exon 17)
Database links

Mature sequence dre-let-7g

Accession MIMAT0001765
Sequence

14 - 

ugagguaguaguuuguauaguu

 - 35

Get sequence
Deep sequencing507024 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).