Stem-loop sequence dre-let-7e

Accession MI0001871
Previous IDs dre-let-7e;dre-let-7e-1
Description Danio rerio let-7e stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      --       cu   gu         a        ---------     c 
gcuguu  cuugggg  gag  aguagauug auaguugu         ggagc c
||||||  |||||||  |||  ||||||||| ||||||||         ||||| u
cgacag  gaauccu  uuc  ucaucuaac uaucaaua         ucucg g
      cg       --   ug         a        gagucucuc     c 
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
23: 5478692-5478791 [-]
intergenic
Clustered miRNAs
< 10kb from dre-let-7e
dre-let-7e 23: 5478692-5478791 [-]
dre-let-7a-5 23: 5478470-5478593 [-]
Database links

Mature sequence dre-let-7e

Accession MIMAT0001763
Sequence

15 - 

ugagguaguagauugaauaguu

 - 36

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).