Stem-loop sequence dre-let-7d-2

AccessionMI0001870 (change log)
Previous IDsdre-let-7d-3
DescriptionDanio rerio let-7d-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

42 open access papers mention dre-let-7d-2
(278 sentences)

Stem-loop
            cu   g   uu            uu  au  uaa 
5' cgcugcagg  gag uag  gguuguaugguu  gc  ca   u
   |||||||||  ||| |||  ||||||||||||  ||  ||   c
3' guggcgucc  uuc auc  ccaacaugucaa  ug  gu   a
            cu   g   uu            -u  ag  ccg 
Get sequence
Deep sequencing
222206 reads, 1.55e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr19: 9429857-9429944 [+]
intergenic
Database links

Mature sequence dre-let-7d-5p

Accession MIMAT0001762
Previous IDsdre-let-7d
Sequence

11 - 

ugagguaguugguuguaugguu

 - 32

Get sequence
Deep sequencing447651 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-let-7d-3p

Accession MIMAT0031931
Sequence

59 - 

cuguacaaccuucuagcuuucc

 - 80

Get sequence
Deep sequencing266 reads, 9 experiments
Evidence not experimental

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).