Stem-loop sequence dre-let-7b

AccessionMI0001865 (change log)
Previous IDsdre-let-7b-2
DescriptionDanio rerio let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

41 open access papers mention dre-let-7b
(217 sentences)

Stem-loop
   ucgga     u                     ---  -----a    ugu 
5'      caggg gagguaguagguugugugguu   uc      gggu   g
        ||||| |||||||||||||||||||||   ||      ||||   u
3'      guccc uuccgucauccaacauaucaa   ag      cccg   u
   gggaa     -                     uug  gacuac    uuu 
Get sequence
Deep sequencing
251651 reads, 1.76e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr4: 18653148-18653241 [-]
intergenic
Clustered miRNAs
< 10kb from dre-let-7b
dre-let-7a-3chr4: 18654155-18654261 [-]
dre-let-7bchr4: 18653148-18653241 [-]
Database links

Mature sequence dre-let-7b

Accession MIMAT0001760
Sequence

11 - 

ugagguaguagguugugugguu

 - 32

Get sequence
Deep sequencing250243 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).