Stem-loop sequence dre-let-7a-6

AccessionMI0001863 (change log)
Previous IDsdre-let-7a-7
DescriptionDanio rerio let-7a-6 stem-loop
Gene family MIPF0000002; let-7
Literature search

43 open access papers mention dre-let-7a-6
(320 sentences)

Stem-loop
      -a   aaccug          ca   ug         gu         ---- g    a       
5' cac  gug      uguguuucuu  agg  agguaguag  uguauaguu    u uggg aggauc 
   |||  |||      ||||||||||  |||  |||||||||  |||||||||    | |||| ||||| a
3' gug  cac      acacagagag  ucc  uccguuauc  acauaucaa    g acuu uccuac 
      ag   -cagua          --   cu         ug         uagu g    a       
Get sequence
Deep sequencing
312503 reads, 2.14e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr6: 54506458-54506586 [-]
intergenic
Database links

Mature sequence dre-let-7a

Accession MIMAT0001759
Sequence

29 - 

ugagguaguagguuguauaguu

 - 50

Get sequence
Deep sequencing1860970 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).