Stem-loop sequence dre-let-7a-5

AccessionMI0001862 (change log)
Previous IDsdre-let-7a-6
DescriptionDanio rerio let-7a-5 stem-loop
Gene family MIPF0000002; let-7
Literature search

43 open access papers mention dre-let-7a-5
(320 sentences)

Stem-loop
   gua  ug    u    u ugg      u          gu         ---u g    -    au 
5'    cg  uuuu ggug c   acaagg gagguaguag  uguauaguu    g uggg aggg  c
      ||  |||| |||| |   |||||| ||||||||||  |||||||||    | |||| ||||   
3'    gu  ggaa ccac g   uguucc uuccguuauc  acauaucaa    c acuu uccc  a
   --c  cu    u    u ---      -          ug         uagu g    g    aa 
Get sequence
Deep sequencing
312482 reads, 2.14e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 5431196-5431319 [-]
intergenic
Clustered miRNAs
< 10kb from dre-let-7a-5
dre-let-7echr23: 5431418-5431517 [-]
dre-let-7a-5chr23: 5431196-5431319 [-]
Database links

Mature sequence dre-let-7a

Accession MIMAT0001759
Sequence

28 - 

ugagguaguagguuguauaguu

 - 49

Get sequence
Deep sequencing1860970 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).