Stem-loop sequence dre-let-7a-4

AccessionMI0001861 (change log)
Previous IDsdre-let-7a-5
DescriptionDanio rerio let-7a-4 stem-loop
Gene family MIPF0000002; let-7
Literature search

43 open access papers mention dre-let-7a-4
(320 sentences)

Stem-loop
      -a  u      au   g   u             ---uaga  ua 
5' gcg  ug cucggg  gag uag agguuguauaguu       gu  c
   |||  || ||||||  ||| ||| |||||||||||||       ||   
3' cgc  ac gagcuc  uuc auc uccgacaugucaa       ca  a
      ag  -      cu   g   c             uagaggg  ca 
Get sequence
Deep sequencing
308520 reads, 2.1e+04 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr5: 29990452-29990544 [+]
intergenic
Clustered miRNAs
< 10kb from dre-let-7a-4
dre-mir-100-2chr5: 29990147-29990221 [+]
dre-let-7a-4chr5: 29990452-29990544 [+]
dre-mir-125b-2chr5: 29998762-29998847 [+]
Database links

Mature sequence dre-let-7a

Accession MIMAT0001759
Sequence

15 - 

ugagguaguagguuguauaguu

 - 36

Get sequence
Deep sequencing1860970 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).