Stem-loop sequence dre-let-7a-2

AccessionMI0001858 (change log)
DescriptionDanio rerio let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

43 open access papers mention dre-let-7a-2
(320 sentences)

Stem-loop
   gcccc    cu   g   u             uagaauaac   ac 
5'      cagg  gag uag agguuguauaguu         auc  u
        ||||  ||| ||| |||||||||||||         |||   
3'      gucc  uuc auc uccaacaugucaa         uag  g
   -uaga    cu   g   c             ---------   ag 
Get sequence
Deep sequencing
308709 reads, 2.1e+04 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr15: 21437876-21437959 [+]
intergenic
Clustered miRNAs
< 10kb from dre-let-7a-2
dre-mir-100-1chr15: 21437633-21437728 [+]
dre-let-7a-2chr15: 21437876-21437959 [+]
dre-mir-125b-1chr15: 21447656-21447800 [+]
Database links

Mature sequence dre-let-7a

Accession MIMAT0001759
Sequence

11 - 

ugagguaguagguuguauaguu

 - 32

Get sequence
Deep sequencing1860970 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).