Stem-loop sequence sbi-MIR156e

AccessionMI0001856
DescriptionSorghum bicolor miR156e stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   cga     c cu  -    au        -    -        c     c  c   c      g 
5'    uuagg c  ga agag  ugacagaa gaga gcgagcac cggcg gg ggc ggcaug a
      ||||| |  || ||||  |||||||| |||| |||||||| ||||| || ||| |||||| g
3'    ggucc g  cu ucuc  acugucuu cucu cgcucgug gccgc cc cug ccguac c
   --g     u cu  c    cg        u    u        c     -  -   -      g 
Get sequence
Deep sequencing
64898 reads, 3.64e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorbi1) Overlapping transcripts
chr_10: 55009872-55009994 [+]
intergenic
Database links

Mature sequence sbi-miR156e

Accession MIMAT0001758
Sequence

21 - 

ugacagaagagagcgagcac

 - 40

Get sequence
Deep sequencing3968 reads, 3 experiments
Evidence by similarity; MI0001504

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).