Stem-loop sequence sbi-MIR395f

AccessionMI0001855 (change log)
DescriptionSorghum bicolor miR395f stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention sbi-MIR395f
(34 sentences)

Stem-loop
   aca     u          c         u             ag     ----a       a 
5'    auguu gguguuacca gaguucccu caagcacuucaug  gcacc     uuaaaua c
      ||||| |||||||||| ||||||||| |||||||||||||  |||||     |||||||  
3'    uacaa ucauaguggu cucaagggg guuugugaaguau  ugugg     aauuuau u
   -gc     c          u         -             aa     auuag       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 57228009-57228130 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR395f
sbi-MIR395echr6: 57228710-57228814 [-]
sbi-MIR395dchr6: 57228519-57228621 [-]
sbi-MIR395cchr6: 57228201-57228273 [-]
sbi-MIR395fchr6: 57228009-57228130 [-]
Database links

Mature sequence sbi-miR395f

Accession MIMAT0001757
Sequence

83 - 

augaaguguuugggggaacuc

 - 103

Get sequence
Evidence by similarity; MI0001536

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).