Stem-loop sequence sbi-MIR164c

AccessionMI0001852 (change log)
DescriptionSorghum bicolor miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

5 open access papers mention sbi-MIR164c
(13 sentences)

Stem-loop
   uau       uu    ag        agca                      ----uu    u   -    ucuc   u 
5'    ggugugu  gugc  gguggaga    ggacacgugagcgaccauccag      ucca cgc uggc    cgc g
      |||||||  ||||  ||||||||    ||||||||||||||||||||||      |||| ||| ||||    ||| c
3'    cuacaug  cacg  ccaccucu    ccuguguacucgcugguggguu      aggu gcg gccg    gcg g
   -gc       gc    ag        ccug                      gcugcu    u   u    --uc   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 68718394-68718546 [-]
intergenic
Database links

Mature sequence sbi-miR164c

Accession MIMAT0001754
Sequence

21 - 

uggagaagcaggacacgugag

 - 41

Get sequence
Evidence by similarity; MI0001105

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).