Stem-loop sequence sbi-MIR399i

AccessionMI0001850 (change log)
DescriptionSorghum bicolor miR399i stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399i
(5 sentences)

Stem-loop
   augcc      --    a   u      uu     uc         a   ----u   --a   c 
5'      uaagcu  gucc guu cagggc  cucuu  uuggcaggg gca     gag   agc a
        ||||||  |||| ||| ||||||  |||||  ||||||||| |||     |||   |||  
3'      auucga  cagg caa gucccg  gagag  aaccgucuc cgu     cuc   ucg u
   ---gu      cu    a   u      uu     ga         c   cuugu   guc   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 54075299-54075419 [+]
intergenic
Database links

Mature sequence sbi-miR399i

Accession MIMAT0001752
Sequence

82 - 

ugccaaaggagaguugcccug

 - 102

Get sequence
Evidence by similarity; MI0001062

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).