Stem-loop sequence zma-MIR160f

AccessionMI0001848 (change log)
DescriptionZea mays miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

21 open access papers mention zma-MIR160f
(71 sentences)

Stem-loop
   -       aagauag              u  c        -  u    -       cac 
5'  gagguga       ggaauaugccuggc cc uguaugcc gc cgca uggcuac   c
    |||||||       |||||||||||||| || |||||||| || |||| |||||||    
3'  cucuauu       uuuuguacggaccg gg gcgugcgg cg gcgu gcuggug   g
   c       --aauaa              u  a        u  -    u       ucc 
Get sequence
Deep sequencing
1349 reads, 740 reads per million, 139 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 241093436-241093551 [-]
intergenic
Database links

Mature sequence zma-miR160f-5p

Accession MIMAT0001750
Previous IDszma-miR160f
Sequence

21 - 

ugccuggcucccuguaugccg

 - 41

Get sequence
Deep sequencing624 reads, 5 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR160f-3p

Accession MIMAT0015209
Previous IDszma-miR160f*
Sequence

79 - 

gcgugcgaggugccaggcaug

 - 99

Get sequence
Deep sequencing139 reads, 121 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).