Stem-loop sequence zma-MIR156k

AccessionMI0001847 (change log)
DescriptionZea mays miR156k stem-loop
Gene family MIPF0000008; MIR156
Literature search

53 open access papers mention zma-MIR156k
(343 sentences)

Stem-loop
   gg      ccc   ---    au        -    -        c     c  c   c      g 
5'   cuuagg   cga   agag  ugacagaa gaga gcgagcac uggcg gg gac ggcaug a
     ||||||   |||   ||||  |||||||| |||| |||||||| ||||| || ||| |||||| a
3'   gagucc   gcu   ucuc  acugucuu cucu cgcucgug gccgc cc cug ccguac c
   --      --u   ccc    cg        u    u        c     -  -   -      g 
Get sequence
Deep sequencing
209748 reads, 6.86e+03 reads per million, 202 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 98967260-98967382 [-]
intergenic
Database links

Mature sequence zma-miR156k-5p

Accession MIMAT0001749
Previous IDszma-miR156k
Sequence

21 - 

ugacagaagagagcgagcac

 - 40

Get sequence
Deep sequencing207570 reads, 196 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR156k-3p

Accession MIMAT0015208
Previous IDszma-miR156k*
Sequence

85 - 

gcucgcuucucuuucugucagc

 - 106

Get sequence
Deep sequencing527 reads, 132 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).