Stem-loop sequence zma-MIR408a

AccessionMI0001846 (change log)
Previous IDszma-MIR408
DescriptionZea mays miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

21 open access papers mention zma-MIR408a
(127 sentences)

Stem-loop
   --------    uugguuuu    u    a      u   a   a   u    u     cau     aaguggagggacuagcuugcgaggcagaaagaaggu 
5'         gggg        gauu ggag caggga gag cag gca ggga ggggc   caaca                                    g
           ||||        |||| |||| |||||| ||| ||| ||| |||| |||||   |||||                                    c
3'         cccc        cuag ccuc gucccu cuc guc cgu cccu ccucg   guugu                                    c
   cguugcca    --------    -    g      u   c   a   c    c     -uu     gaggguaguagcaaaguggccccuccguggccguga 
Get sequence
Deep sequencing
2676 reads, 2.19e+03 reads per million, 200 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 58127890-58128080 [-]
intergenic
Database links

Mature sequence zma-miR408a

Accession MIMAT0001748
Previous IDszma-miR408
Sequence

152 - 

cugcacugccucuucccuggc

 - 172

Get sequence
Deep sequencing817 reads, 164 experiments
Evidence by similarity; MI0001149
Database links

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).