Stem-loop sequence zma-MIR393a

AccessionMI0001845 (change log)
Previous IDszma-MIR393
DescriptionZea mays miR393a stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention zma-MIR393a
(75 sentences)

Stem-loop
   cc   aa  u         c           c          au  -  -  c   --   c    
5'   agg  gc gguggagga uccaaagggau gcauugaucu  uc uc ac ugc  cgc ugc 
     |||  || ||||||||| ||||||||||| ||||||||||  || || || |||  ||| || u
3'   ucc  cg ucaccuuuu agguuucccua cgugacuaga  ag ag ug gcg  gcg acg 
   cu   -g  c         a           a          ac  c  c  a   ua   u    
Get sequence
Deep sequencing
2167 reads, 1.9e+03 reads per million, 176 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 738724-738849 [+]
intergenic
Database links

Mature sequence zma-miR393a-5p

Accession MIMAT0001747
Previous IDszma-miR393;zma-miR393a
Sequence

21 - 

uccaaagggaucgcauugaucu

 - 42

Get sequence
Deep sequencing782 reads, 140 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR393a-3p

Accession MIMAT0015207
Previous IDszma-miR393a*
Sequence

88 - 

aucagugcaaucccuuuggaau

 - 109

Get sequence
Deep sequencing272 reads, 39 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).