Stem-loop sequence zma-MIR171h

AccessionMI0001844 (change log)
DescriptionZea mays miR171h stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

20 open access papers mention zma-MIR171h
(52 sentences)

Stem-loop
   -     ga     acg      c         u             cuucuu  a        ug 
5'  gggag  aggag   acaugg gugguauug uucggcucauguc      cg ucgagucu  c
    |||||  |||||   |||||| ||||||||| |||||||||||||      || ||||||||  c
3'  cccuu  uucuc   uguacu cacuauaac aagccgaguguag      gu gguuuagg  g
   a     ac     --a      -         c             -----u  a        uu 
Get sequence
Deep sequencing
592 reads, 582 reads per million, 142 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 18027100-18027223 [-]
intergenic
Database links

Mature sequence zma-miR171h-5p

Accession MIMAT0015206
Previous IDszma-miR171h*
Sequence

24 - 

ugguauuguuucggcucaugu

 - 44

Get sequence
Deep sequencing82 reads, 15 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR171h-3p

Accession MIMAT0001746
Previous IDszma-miR171h
Sequence

85 - 

gugagccgaaccaauaucacu

 - 105

Get sequence
Deep sequencing122 reads, 111 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).