Stem-loop sequence zma-MIR171k

AccessionMI0001843 (change log)
DescriptionZea mays miR171k stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

19 open access papers mention zma-MIR171k
(50 sentences)

Stem-loop
   -g    -      gacg      c         u             - u   u 
5'   ggag gaagaa    acaugg gugguauug uucggcucauguc c ucu g
     |||| ||||||    |||||| ||||||||| ||||||||||||| | ||| a
3'   ucuu cuucuu    uguacu cacuauaac aagccgaguguag g agg c
   ag    a      ---a      -         c             u u   u 
Get sequence
Deep sequencing
245 reads, 245 reads per million, 134 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 138536838-138536941 [-]
intergenic
Database links

Mature sequence zma-miR171k-5p

Accession MIMAT0015205
Previous IDszma-miR171k*
Sequence

24 - 

ugguauuguuucggcucaugu

 - 44

Get sequence
Deep sequencing82 reads, 15 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR171k-3p

Accession MIMAT0001745
Previous IDszma-miR171k
Sequence

65 - 

gugagccgaaccaauaucacu

 - 85

Get sequence
Deep sequencing122 reads, 111 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).