Stem-loop sequence zma-MIR166m

AccessionMI0001842 (change log)
DescriptionZea mays miR166m stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166m
(189 sentences)

Stem-loop
   uccuuggucu    --------              uu g    cu   g  a  -  ---c    u   u  ca  c    c     uc 
5'           gggg        guuuguggggaaug  g cugg  cga gc uc cg    gucc ggc cg  gu gcag gcaga  g
             ||||        ||||||||||||||  | ||||  ||| || || ||    |||| ||| ||  || |||| |||||   
3'           cccc        caaacgcuccuuac  c gacc  gcu cg ag gc    cagg ccg gc  ca cguc cguuu  u
   ---------a    uacguggc              uu g    ag   g  g  a  uaga    -   -  --  u    -     ug 
Get sequence
Deep sequencing
157700 reads, 9.91e+03 reads per million, 200 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 216484037-216484192 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR166m
zma-MIR166mchr5: 216484037-216484192 [-]
zma-MIR166kchr5: 216483766-216483933 [-]
Database links

Mature sequence zma-miR166m-5p

Accession MIMAT0015204
Previous IDszma-miR166m*
Sequence

23 - 

ggaauguuggcuggcucgagg

 - 43

Get sequence
Deep sequencing715 reads, 146 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR166m-3p

Accession MIMAT0001744
Previous IDszma-miR166m
Sequence

117 - 

ucggaccaggcuucauuccuc

 - 137

Get sequence
Deep sequencing154902 reads, 183 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).