Stem-loop sequence zma-MIR166l

AccessionMI0001841 (change log)
DescriptionZea mays miR166l stem-loop
Gene family MIPF0000004; MIR166
Literature search

33 open access papers mention zma-MIR166l
(189 sentences)

Stem-loop
   aaagaa      - a      cu         g       a     cuuagguguuaaagcauuauauu 
5'       cgggag g ggguuu  ggaauggag cuggucc agauc                       g
         |||||| | ||||||  ||||||||| ||||||| |||||                        
3'       gcccuc c cccaaa  ccuuacuuc gaccagg ucuag                       c
   --caca      g a      cu         g       c     aguuuguguuuuggucuuuguuc 
Get sequence
Deep sequencing
155573 reads, 8.5e+03 reads per million, 198 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 91435335-91435471 [+]
intergenic
Database links

Mature sequence zma-miR166l-5p

Accession MIMAT0015203
Previous IDszma-miR166l*
Sequence

24 - 

gaauggaggcugguccaaga

 - 43

Get sequence
Deep sequencing342 reads, 122 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR166l-3p

Accession MIMAT0001743
Previous IDszma-miR166l
Sequence

98 - 

ucggaccaggcuucauuccuc

 - 118

Get sequence
Deep sequencing154958 reads, 196 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).