Stem-loop sequence zma-MIR172e

AccessionMI0001840 (change log)
DescriptionZea mays miR172e stem-loop
Gene family MIPF0000035; MIR172
Literature search

36 open access papers mention zma-MIR172e
(211 sentences)

Stem-loop
   cagcc    gg    u  ug a ug               a     ugcaugccaacauaaugcgcguguucaugcauccaucgcc 
5'      agcc  ugau uc  g g  gcaucaucaagauuc cacac                                        g
        ||||  |||| ||  | |  ||||||||||||||| |||||                                        c
3'      ucgg  acua ag  u c  cguaguaguucuaag gugug                                        c
   -uaua    ga    u  gu a gu               g     uauguguauauauauauaauauauacuacguacuacgucg 
Get sequence
Deep sequencing
2756 reads, 601 reads per million, 138 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 145801592-145801765 [+]
intergenic
Database links

Mature sequence zma-miR172e

Accession MIMAT0001742
Sequence

135 - 

ggaaucuugaugaugcugcau

 - 155

Get sequence
Deep sequencing2353 reads, 6 experiments
Evidence by similarity; MI0001140
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).