Stem-loop sequence zma-MIR171g

AccessionMI0001839 (change log)
DescriptionZea mays miR171g stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

19 open access papers mention zma-MIR171g
(50 sentences)

Stem-loop
   aga   --  gc       ca        a              cg  ca   ca aa 
5'    acg  ag  gacaugg  ugguauug cuuggcucaucucu  cc  cac  g  u
      |||  ||  |||||||  |||||||| ||||||||||||||  ||  |||  |   
3'    ugc  uc  cuguacu  acuauaac gagccgaguggagg  gg  gug  c  c
   ---   ga  ua       uc        c              -a  cc   aa ac 
Get sequence
Deep sequencing
789 reads, 891 reads per million, 147 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 44057814-44057925 [-]
intergenic
Database links

Mature sequence zma-miR171g-5p

Accession MIMAT0015202
Previous IDszma-miR171g*
Sequence

23 - 

uauugacuuggcucaucucuc

 - 43

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence by similarity; MI0001138

Mature sequence zma-miR171g-3p

Accession MIMAT0001741
Previous IDszma-miR171g
Sequence

73 - 

gaggugagccgagccaauauc

 - 93

Get sequence
Deep sequencing143 reads, 123 experiments
Evidence by similarity; MI0001138

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).